|
Thermo Fisher
rabbit zo 2 Rabbit Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit zo 2/product/Thermo Fisher Average 99 stars, based on 1 article reviews
rabbit zo 2 - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rabbit anti zo 2 antibody Rabbit Anti Zo 2 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti zo 2 antibody/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
rabbit anti zo 2 antibody - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit anti–zo-2 pab Rabbit Anti–Zo 2 Pab, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti–zo-2 pab/product/Thermo Fisher Average 90 stars, based on 1 article reviews
rabbit anti–zo-2 pab - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
zo2 polyclonal rabbit Zo2 Polyclonal Rabbit, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zo2 polyclonal rabbit/product/Cell Signaling Technology Inc Average 95 stars, based on 1 article reviews
zo2 polyclonal rabbit - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Thermo Fisher
polyclonal rabbit anti zo 2 antibody no 71 1400 ![]() Polyclonal Rabbit Anti Zo 2 Antibody No 71 1400, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/polyclonal rabbit anti zo 2 antibody no 71 1400/product/Thermo Fisher Average 86 stars, based on 1 article reviews
polyclonal rabbit anti zo 2 antibody no 71 1400 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
anti-rabbit zona occluding-2 ![]() Anti Rabbit Zona Occluding 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-rabbit zona occluding-2/product/Thermo Fisher Average 90 stars, based on 1 article reviews
anti-rabbit zona occluding-2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit polyclonals against zo2 ![]() Rabbit Polyclonals Against Zo2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonals against zo2/product/Thermo Fisher Average 86 stars, based on 1 article reviews
rabbit polyclonals against zo2 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
zo2 ![]() Zo2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zo2/product/Santa Cruz Biotechnology Average 96 stars, based on 1 article reviews
zo2 - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit anti zo 2 ![]() Rabbit Anti Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti zo 2/product/Thermo Fisher Average 86 stars, based on 1 article reviews
rabbit anti zo 2 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
antibodies against zo2 (santa cruz biotechnology sc-11448, rabbit igg ![]() Antibodies Against Zo2 (Santa Cruz Biotechnology Sc 11448, Rabbit Igg, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibodies against zo2 (santa cruz biotechnology sc-11448, rabbit igg/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
antibodies against zo2 (santa cruz biotechnology sc-11448, rabbit igg - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rabbit polyclonal anti-zo-2 (h-110) antibody ![]() Rabbit Polyclonal Anti Zo 2 (H 110) Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonal anti-zo-2 (h-110) antibody/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-zo-2 (h-110) antibody - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
zo-2 ![]() Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zo-2/product/Thermo Fisher Average 90 stars, based on 1 article reviews
zo-2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: BMC Gastroenterology
Article Title: Role of tight junction proteins in gastroesophageal reflux disease
doi: 10.1186/1471-230X-12-128
Figure Lengend Snippet: Characteristics of primers, RT-PCR protocol and antibodies
Article Snippet: ZO-2 , fw: AGAGGACACGCCGAGCAGATTG rv: TCCCGACATCATTGCCACCAG 272 bp, 60°C ,
Techniques: Sequencing
Journal: Journal of molecular medicine (Berlin, Germany)
Article Title: Acid sphingomyelinase inhibition protects mice from lung edema and lethal Staphylococcus aureus sepsis.
doi: 10.1007/s00109-014-1246-y
Figure Lengend Snippet: Fig. 4 Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus. Immunofluores- cence stainings were performed with antibodies against ZO1, ZO2, occludin, or E-cadherin for determination of the degradation of these TJ proteins. The present- ed pictures are representative of the results of at least three inde- pendent experiments. Scale bar is 25 μm
Article Snippet: Samples were washed and incubated overnight at 4 °C with antibodies against ZO1 (Invitrogen 40-2300, rabbit IgG),
Techniques: Infection
Journal: Journal of Molecular Medicine (Berlin, Germany)
Article Title: Acid sphingomyelinase inhibition protects mice from lung edema and lethal Staphylococcus aureus sepsis
doi: 10.1007/s00109-014-1246-y
Figure Lengend Snippet: Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus . Immunofluorescence stainings were performed with antibodies against ZO1, ZO2, occludin, or E-cadherin for determination of the degradation of these TJ proteins. The presented pictures are representative of the results of at least three independent experiments. Scale bar is 25 μm
Article Snippet: Samples were washed and incubated overnight at 4 °C with antibodies against ZO1 (Invitrogen 40-2300, rabbit IgG),
Techniques: Infection, Immunofluorescence
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A) Representative images of DNA, YAP, and ZO-2 at the lateral plane in MDCK cells under different cell-density conditions. Scale bar, 25 µm. (B) Representative images of ZO-2 depleted cells at confluent cell density 72 hours after seeding. Distributions of DNA, E-cadherin, YAP, and ZO-1 are shown as X-Y views (ZO-1 is at the apical plane, and all others at the lateral plane), and those of YAP, DNA, and gp135 are shown as cross-sectional views. Scale bar, 25 µm. (C) Representative immunoblotting images for ZO-2 and GAPDH from extracts of ZO-2 depleted cells. (D) Quantification of the ratio of YAP intensities in the nucleus relative to that in the cytoplasm in cells shown in (B). Data in box-and-whisker plots show median (midline), 25 th to 75 th percentiles (box), and minimum and maximum (whiskers) from n = 20 cells for each condition. p -values; student’s t-test. (E) Representative immunoblotting images for ZO-2, LATS1, S909-phosphorylated LATS1 (pLATS S909), YAP, S127-phosphorylated YAP (pYAP S127), MST1, T183/T180-phosphorylated MST1/2 (pMST1 T183 / pMST2 T180), GAPDH, histone H3 (H3), and S10-phosphorylated histone H3 (pH3 S10) from extracts of control cells and ZO-2 depleted cells at different cell densities.
Article Snippet:
Techniques: Western Blot, Whisker Assay
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: Representative images of MDCK cells and those depleted of ZO-2 at the low cell density. The distributions of DNA and YAP are shown as X-Y views. Scale bar, 10 µm.
Article Snippet:
Techniques:
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A and B) ZO-2 is required to maintain the levels of LATS1 protein at high cell density. (A) Representative immunoblotting images for ZO-2, endogenous LATS1 (longer exposure: LE, shorter exposure: SE), S909-phosphorylated LATS1 (pLATS S909), YAP, S127-phosphorylated YAP (pYAP S127), and GAPDH from extracts of control and ZO-2 depleted cells. (B) FLAG-LATS1 and HA-ZO-2 immunoblotting images from control and ZO-2 depleted cells with or without ZO-2 transgene are shown. (C) Lats1 mRNA abundance is unaffected by ZO-2 knockdown. The graph depicts the levels of Lats1 mRNA (normalized to those of Gapdh mRNA) measured by RT-qPCR. Plots represent mean values ± s.d. from three independent experiments. p -values; Mann-Whitney test. (D) ZO-2 limits poly-ubiquitination of LATS1 in cells at high density. Representative immunoblotting images for poly-ubiquitin moiety, FLAG-LATS-1, HA-ZO-2, and GAPDH from the FLAG-LATS1 immuno-precipitates are shown. FLAG-LATS1 were immune-precipitated from extracts of control and ZO-2 depleted cells with or without ZO-2 transgene. (E) Inhibition of poly-ubiquitination increases the LATS1 protein level in ZO-2-depleted cells. Representative immunoblotting images for ZO-2, LATS1, S909-phosphorylated LATS1 (pLATS1 S909), YAP, S127-phosphorylated YAP (pYAP S127), and GAPDH from extracts of control cells, and ZO-2 depleted cells with or without the expression of HA-ubiquitin K0 are shown. (F) Inhibition of proteasome activity increases the LATS1 protein level in ZO-2 depleted cells. Representative immunoblotting images for ZO-2, LATS1, and S909-phosphorylated LATS1 (pLATS1 S909), YAP, S127-phosphorylated YAP (pYAP S127), and GAPDH from extracts of control cells, and ZO-2 depleted cells with or without MG132 treatment are shown. (G) A model of proteasome-mediated degradation of LATS1. ZO-2 antagonizes with poly-ubiquitination and degradation of LATS1. (H) Increased levels in LATS1 protein is insufficient for the restoration of nuclear-to-cytoplasm translocation of YAP in ZO-2 depleted cells. Left: representative images of cells depleted of ZO-2 with or without MG132 treatment. Right: representative images of ZO-2 depleted cells with FLAG-ZO-2 transgene after MG132 treatment. The distributions of YAP were visualized 72 hours after seeding. Scale bar, 25 µm. (I) Quantification of the ratio of YAP intensities in the nucleus relative to that in the cytoplasm from cells shown in (F). Data in box-and-whisker plots show median (midline), 25 th to 75 th percentiles (box), and minimum and maximum (whiskers) from n = 71, 37, 62 cells for each condition. p -values; student’s t-test.
Article Snippet:
Techniques: Western Blot, Quantitative RT-PCR, MANN-WHITNEY, Inhibition, Expressing, Activity Assay, Translocation Assay, Whisker Assay
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A) Diagrammatic representation of HA-tagged ZO-2 fragments used in (B). (B) Representative images of MDCK cells expressing full-length HA-ZO-2 or HA-ZO-2[1-590 aa]. Distributions of DNA, HA-ZO-2 fusions, and YAP are shown as X-Y views. The area of nuclei in cells expressing HA-tagged ZO2 are marked by white dotted lines. Scale bar, 25 µm.
Article Snippet:
Techniques: Expressing
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A and B) Representative immunoblotting images for (A) ZO-2 and LATS1, (B) ZO-2 and YAP in the ZO-2 immunoprecipitates. ZO-2 was immunoprecipitated from extracts of cells at different cell-density conditions. Levels of ZO-2, LATS1, YAP, and GAPDH in cell extracts are shown as inputs. (C) ZO-2 stimulates an interaction between LATS1 and YAP at high cell density. Representative immunoblotting images for LATS1 and FLAG-YAP in the FLAG-YAP immunoprecipitates are shown. FLAG-YAP was immunoprecipitated from extracts of control cells and ZO-2 depleted cells at high density. Levels of ZO-2 and LATS1 in cell extracts are shown as inputs. (D) Diagrammatic representation of HA-tagged ZO-2 fragments used in (E) and (F). (E) ZO-2 associates with LATS1 via the SH3 domain. Representative immunoblotting images for HA-tagged ZO-2 fragments and FLAG-LATS1 in the FLAG-LATS1 immuno-precipitates are shown. FLAG-LATS1 was immunoprecipitated from the extracts of cells expressing various ZO-2 fragments. Levels of HA-ZO-2 fragments and GAPDH in cell extracts are shown as inputs. (F) The interaction between LATS1 and YAP requires the SH3 domain of ZO-2. Representative immunoblotting images for LATS1 and FLAG-YAP in the FLAG-YAP immunoprecipitates. FLAG-YAP was immunoprecipitated from extracts of ZO-2 depleted cells expressing HA-EV, HA-ZO-2, or HA-ZO-2(ΔSH3). Levels of HA-ZO-2, HA-ZO-2(ΔSH3), LATS1, FLAG-YAP, and GAPDH in cell extracts are shown as inputs. (G and H) LATS1 interacts with ZO-2 through its SH3 domain-binding motifs. Representative immunoblotting images for HA-ZO-2, FLAG-LATS1, and GAPDH in FLAG-LATS1 immunoprecipitates are shown. FLAG-LATS1 fusions were immunoprecipitated from extracts of cells at high density. The levels of HA-ZO-2, FLAG-LATS1, and GAPDH in cell extracts are shown as inputs. (I) ZO-2 acts as a scaffold that associates with both LATS1 and YAP. Representative immunoblotting images for HA-LATS1, HA-ZO-2, and FLAG-YAP in the FLAG-YAP immunoprecipitates. FLAG-YAP was immunoprecipitated from extracts of cells expressing various levels of ZO-2. Levels of HA-ZO-2 and HA-LATS1 in cell extracts are shown as inputs. (J) Diagrammatic representation of the formation of a tripartite complex comprising LATS1–ZO-2–YAP.
Article Snippet:
Techniques: Western Blot, Immunoprecipitation, Expressing, Binding Assay
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A and B) ZO-2 recruits S909-phosphorylated LATS1 to the apical junctions. Representative distributions of S909-phosphorylated LATS1 (pLATS1 S909) in control cells and ZO-2 depleted cells (A) and ZO-2 depleted cells with FLAG-ZO-2 transgene (B). Scale bar, 25 µm. (C) ZO-2 associates with S909-phosphorylated LATS1. Representative immunoblotting images for S909-phosphorylated LATS1 (pLATS1 S909) and ZO-2 in the ZO-2 immunoprecipitates. ZO-2 was immunoprecipitated from extracts of cells at high density. Levels of pLATS1 S909, ZO-2, and GAPDH in cell extracts are shown as inputs. (D) Representative immunoblotting images for ZO-1, ZO-2, and GAPDH in control cells and ZO-1 depleted cells. (E) ZO-1-dependent tight junctions are essential for the recruitment of ZO-2 and S909-phosphorylated LATS1 to the apical junctions. Representative distributions of ZO-2 and S909-phosphorylated LATS1 (pLATS1 S909) in control cells and ZO-1 depleted cells. Scale bar, 25 µm. (F) ZO-1-dependent tight junction is essential for efficient phosphorylation of LATS1 and YAP. Representative immunoblotting images for ZO-1, LATS1, S909-phosphorylated LATS1 (pLATS1 S909), YAP, S127-phosphorylated YAP (pYAP S127), MST1, T183/T180-phosphorylated MST1/2 (pMST1 T183 / pMST2 T180), and GADPH in extracts of control cells and ZO-1 depleted cells are shown. (G) ZO-1-dependent tight junctions are required for effective translocation of YAP from the nucleus to the cytoplasm. Representative distributions of DNA, YAP, and ZO-2 in control cells and ZO-1 depleted cells at high density are shown as X-Y views (top) and cross-sectional views (bottom). Scale bar, 25 µm. (H and I) Quantification of the ratio of YAP intensities (H) and ZO-2 intensities (I) in the nucleus relative to that in the cytoplasm from cells shown in (G). Data in box-and-whisker plots show median (midline), 25 th to 75 th percentiles (box), and minimum and maximum (whiskers) from n = 20 cells (H) and n = 30 cells (I) for each condition. p -values; student’s t-test.
Article Snippet:
Techniques: Western Blot, Immunoprecipitation, Translocation Assay, Whisker Assay
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A) ZO-1 is dispensable for the formation of LATS1–ZO-2–YAP tripartite complex. Representative immunoblotting images for LATS1 and FLAG-YAP in the FLAG-YAP immunoprecipitates are shown. FLAG-YAP was immunoprecipitated from extracts of control cells and ZO-1 depleted cells at high density. Levels of ZO-1, LATS1, FLAG-YAP, and GAPDH in cell extracts are shown as inputs. (B-D) Recruitment of tight-junctional proteins, Amot or NF2, to the LATS1-ZO-2-YAP tripartite complex induces efficient phosphorylation of LATS1 and YAP. (B) Diagrammatic representation of artificial recruitment of Amot and NF2 to ZO-2. (C and D) Recruitment of Amot and NF2 to the LATS1-ZO-2-YAP tripartite complex induces efficient nuclear exit of YAP. (C) Representative images of YAP distribution in ZO-1 depleted cells expressing YFP-FRB and CFP-FKBP after AP21967 treatment and in those expressing YFP-ZO-2-FRB and either CFP-FKBP-Amot or CFP-FKBP-NF2 before and after AP21967 treatment are shown. Scale bar, 25 µm. (D) Quantification of the ratio of YAP intensities in the nucleus relative to that in the cytoplasm from cells shown in (C). Data in box-and-whisker plots show median (midline), 25 th to 75 th percentiles (box), and minimum and maximum (whiskers) from n = 25, 18, 22, 15, 9, 12 cells for each condition. p -values; Mann-Whitney test.
Article Snippet:
Techniques: Western Blot, Immunoprecipitation, Expressing, Whisker Assay, MANN-WHITNEY
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A) Representative immunoblotting images for FLAG-ZO-1, HA-ZO-2, HA-MST-1/2, HA-LATS1, and HA-YAP in FLAG-ZO-1 immunoprecipitates. FLAG-ZO-1 was immunoprecipitated from extracts of cells at high density. Levels of FLAG-ZO-1, HA-ZO-2, HA-MST-1/2, HA-LATS1, HA-YAP, and GAPDH from cell extracts are shown as inputs. (B) Representative immunoblotting images for FLAG-MST1, FLAG-YAP, and HA-LATS1 in FLAG immunoprecipitates. FLAG fusions were immunoprecipitated from extracts of cells at high density. Levels of FLAG-MST1, FLAG-YAP, HA-LATS1, and GAPDH from cell extracts are shown as inputs.
Article Snippet:
Techniques: Western Blot, Immunoprecipitation
Journal: bioRxiv
Article Title: ZO-2 induces cytoplasmic retention of YAP by promoting a LATS1-ZO-2-YAP complex at tight junctions
doi: 10.1101/355081
Figure Lengend Snippet: (A) Representative immunoblotting images for LATS1, S909-phosphoryalted LATS1 (pLATS1 S909), YAP, S127-phosphorylated YAP (pYAP S127), and GAPDH from extracts of ZO-1-depleted cells expressing CFP-FKBP-Amot, CFP-FKBP, YFP-ZO-2-FRB, and YFP-FRB before and after AP21967 treatment are shown. (B) Representative immunoblotting images for LATS1, S909-phosphoryalted LATS1 (pLATS1 S909), YAP, S127-phosphorylated YAP (pYAP S127), and GAPDH from extracts of ZO-1-depleted cells expressing CFP-FKBP-NF2, CFP-FKBP, YFP-ZO-2-FRB and YFP-FRB before and after AP21967 treatment are shown.
Article Snippet:
Techniques: Western Blot, Expressing